| Internal ID | 17857836 | Source Database | TransTermHP TERM 69 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 69
|
| Sequence |
GGCCGGGGAGCGCTGCTCACCGGCC Look for more occurrences |
| Start | 348372 |
| End | 348396 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA018 genomic scaffold adgfT-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGTCGACGAAAAAAA(5' tail) GGCCGGTGAGC(5' stem) AGC(loop) GCTCCCCGGCC(3' stem) TTTTTCGTTACGAGG(3' tail). Confidence: 100. opp_overlap 348372 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|