| Internal ID | 17855877 | Source Database | TransTermHP TERM 173 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 173
|
| Sequence |
CCCGGCTCCCCTGAGCCTGGG Look for more occurrences |
| Start | 736429 |
| End | 736449 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA021 genomic scaffold adgeQ-supercont1.2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGATCTCTAGAATA(5' tail) CCC-GGCTC(5' stem) CCCT(loop) GAGCCTGGG(3' stem) TTTGTTTCGCCTGGC(3' tail). Confidence: 91. gap 1, opp_overlap 736429 736427, overlap 736429 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|