| Internal ID | 17855276 | Source Database | TransTermHP TERM 649 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 649
|
| Sequence |
GACCTCGCCGAGGCATCGGCGGGGTC Look for more occurrences |
| Start | 2912140 |
| End | 2912165 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA021 genomic scaffold adgeQ-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCTCTTTCGGAGAAA(5' tail) GACCCCGCCGA(5' stem) TGCC(loop) TCGGCGAGGTC(3' stem) TTCGCGTCTCGACTC(3' tail). Confidence: 100. opp_overlap 2912142 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|