| Internal ID | 17846910 | Source Database | TransTermHP TERM 346 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 346
|
| Sequence |
GCCCGGCCATCGAGCCGGGC Look for more occurrences |
| Start | 1293317 |
| End | 1293336 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BL02 genomic scaffold adggf-supercont1.3, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCCGCAGCGAAAGA(5' tail) GCCCGGC(5' stem) CATCGA(loop) GCCGGGC(3' stem) TTTTTCGTGGGGGAC(3' tail). Confidence: 100. opp_overlap 1293317 1293315 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|