Internal ID | 17846866 | Source Database | TransTermHP TERM 274 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 274
|
Sequence |
GGGCCGGCGCGAGGTGCGTCGGCCC Look for more occurrences |
Start | 991681 |
End | 991705 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BL02 genomic scaffold adggf-supercont1.3, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GACGCCTGAAGCGAC(5' tail) GGGCCGGCGCG(5' stem) AGG(loop) TGCGTCGGCCC(3' stem) TTTTTCGGAAAAAGG(3' tail). Confidence: 100. opp_overlap 991680 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|