Internal ID | 17845165 | Source Database | TransTermHP TERM 190 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 190
|
Sequence |
CCCGCGTACCCGCAAAGGACGCGGG Look for more occurrences |
Start | 921232 |
End | 921256 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BL03 genomic scaffold adgeM-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGGGCATGAAAAAA(5' tail) CCCGCGT-CC(5' stem) TTTGCG(loop) GGTACGCGGG(3' stem) CCTCTGCCTCGACGC(3' tail). Confidence: 100. gap 1, opp_overlap 921188 921188 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|