| Internal ID | 17842734 | Source Database | TransTermHP TERM 128 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 128
|
| Sequence |
GGCCGCTGATACCAGCGGCC Look for more occurrences |
| Start | 552641 |
| End | 552660 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BL06 genomic scaffold adgfq-supercont1.4, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAACCCGAAAAAAAA(5' tail) GGCCGCTG(5' stem) GTAT(loop) CAGCGGCC(3' stem) TTGAGAAGACGTCGA(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|