Internal ID | 17842724 | Source Database | TransTermHP TERM 111 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 111
|
Sequence |
GAGGCTTCACGGAAACGGAAGCCTC Look for more occurrences |
Start | 428970 |
End | 428994 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BL06 genomic scaffold adgfq-supercont1.4, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCCTGGCAGAAAAAA(5' tail) GAGGCTTC-CG(5' stem) TTTC(loop) CGTGAAGCCTC(3' stem) TGAAAGAAAGGCCCG(3' tail). Confidence: 100. gap 1 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|