| Internal ID | 17841592 | Source Database | TransTermHP TERM 630 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 630
|
| Sequence |
GAACCCCGGCCATGAGCCGGGGTTC Look for more occurrences |
| Start | 3029256 |
| End | 3029280 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BL07 genomic scaffold adgfo-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAATCAGGAACGAA(5' tail) GAACCCCGGC(5' stem) TCATG(loop) GCCGGGGTTC(3' stem) TTCGTTCCATCTCAG(3' tail). Confidence: 93. opp_overlap 3029256 3029252 3029259, overlap 3029252 3029248 3029259 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|