Internal ID | 17839876 | Source Database | TransTermHP TERM 706 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 706
|
Sequence |
GAAGCCCCGCTATGGCGGGGCTTC Look for more occurrences |
Start | 3359625 |
End | 3359648 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BL09 genomic scaffold adgge-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCCGATTCGATAAAA(5' tail) GAAGCCCCGC(5' stem) CATA(loop) GCGGGGCTTC(3' stem) TTGTTTTCACGCGAG(3' tail). Confidence: 100. opp_overlap 3359625 3359628 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|