| Internal ID | 17836515 | Source Database | TransTermHP TERM 173 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 173
|
| Sequence |
GAACCCCGGCTCATGGCCGGGGTTC Look for more occurrences |
| Start | 751663 |
| End | 751687 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BL12 genomic scaffold adgfc-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGCGATGGAACGAA(5' tail) GAACCCCGGCC(5' stem) ATG(loop) AGCCGGGGTTC(3' stem) TTCGTTACGGATTGC(3' tail). Confidence: 93. opp_overlap 751663 751666, overlap 751659 751666 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|