| Internal ID | 17832283 | Source Database | TransTermHP TERM 158 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 158
|
| Sequence |
GCCCCGGCGCTTGGCCGGGGC Look for more occurrences |
| Start | 473078 |
| End | 473098 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BL17 genomic scaffold adggm-supercont1.2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCCCGTCCCAGGAAA(5' tail) GCCCCGGC(5' stem) CAAGC(loop) GCCGGGGC(3' stem) TTTTCGTTCCTGCCC(3' tail). Confidence: 90. opp_overlap 473072 473078 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|