| Internal ID | 17829471 | Source Database | TransTermHP TERM 308 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 308
|
| Sequence |
GCCAGGAGCCGCATGGCTCCTGGG Look for more occurrences |
| Start | 1044390 |
| End | 1044413 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BL20 genomic scaffold adgeI-supercont1.3, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTGCGTAACAAGCAA(5' tail) GCCAGGAGCC(5' stem) GCAT(loop) GGCTCCTGGG(3' stem) TTTTGCTCGTGCCCT(3' tail). Confidence: 91. opp_overlap 1044386 1044390 1044391, overlap 1044391 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|