Internal ID | 17817064 | Source Database | TransTermHP TERM 47 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 47
|
Sequence |
GAGGCTTCACGGAAACGGAAGCCTC Look for more occurrences |
Start | 347231 |
End | 347255 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa C23 genomic scaffold adggj-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGGGCCTTTCTTTCA(5' tail) GAGGCTTCACG(5' stem) GAAA(loop) CG-GAAGCCTC(3' stem) TTTTTTCTGCCAGGG(3' tail). Confidence: 100. gap 1 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|