| Internal ID | 17815431 | Source Database | TransTermHP TERM 464 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 464
|
| Sequence |
GACCTCGCCGAGGCATCGGCGGGGTC Look for more occurrences |
| Start | 1814296 |
| End | 1814321 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa C41 genomic scaffold adgfh-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAGTCGAGACGCGAA(5' tail) GACCTCGCCGA(5' stem) GGCA(loop) TCGGCGGGGTC(3' stem) TTTCTCCGAAAGAGG(3' tail). Confidence: 93. opp_overlap 1814298 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|