Internal ID | 17814904 | Source Database | TransTermHP TERM 114 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 114
|
Sequence |
GAATGACTGGAAACAGGCATTC Look for more occurrences |
Start | 458467 |
End | 458488 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa C48 genomic scaffold adgeZ-supercont1.2, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCGATCTGACAAAAA(5' tail) GAATGCCTG(5' stem) TTTC(loop) CAGTCATTC(3' stem) GCGTTACGTGCACCG(3' tail). Confidence: 90. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|