| Internal ID | 17813883 | Source Database | TransTermHP TERM 48 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 48
|
| Sequence |
GGCCCGCGCGTCCGCGCGGGTC Look for more occurrences |
| Start | 297792 |
| End | 297813 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa C51 genomic scaffold adgeS-supercont1.4, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AAGCGATACCCCCGA(5' tail) GGCCCGCGC(5' stem) GTCC(loop) GCGCGGGTC(3' stem) TTTCTTTCAGAGGCT(3' tail). Confidence: 100. opp_overlap 297783 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|