Internal ID | 17811045 | Source Database | TransTermHP TERM 144 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 144
|
Sequence |
GGCTCACCTCCGGGTGGGCC Look for more occurrences |
Start | 527082 |
End | 527101 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa CF614 genomic scaffold adggb-supercont1.3, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TGAATACGACGAAAA(5' tail) GGCTCACC(5' stem) TCCG(loop) GGTGGGCC(3' stem) TTTTTGCTTTCCGCC(3' tail). Confidence: 100. opp_overlap 527082 527076, overlap 527076 527075 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|