| Internal ID | 17808811 | Source Database | TransTermHP TERM 123 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 123
|
| Sequence |
CGCCGCATATGATATGCGGCG Look for more occurrences |
| Start | 522145 |
| End | 522165 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa MSH-10 genomic scaffold acUKG-supercont1.2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAAGGCAAAAAAAAA(5' tail) CGCCGCATA(5' stem) TCA(loop) TATGCGGCG(3' stem) CAAGGACAGGGTACC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|