| Internal ID | 17804730 | Source Database | TransTermHP TERM 2 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 2
|
| Sequence |
CCCCGGCAGCAATGCCGGGG Look for more occurrences |
| Start | 1484 |
| End | 1503 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas thermotolerans J53 PsesuJ47DRAFT_scaffold_25.26_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGGGAAAAAGAAAA(5' tail) CCCCGGCA(5' stem) TTGC(loop) TGCCGGGG(3' stem) CTCTCCAACGACACC(3' tail). Confidence: 100. overlap 1479 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|