| Internal ID | 17803725 | Source Database | TransTermHP TERM 64 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 64
|
| Sequence |
GCCCGGGCGAGATTCGCTCGGGC Look for more occurrences |
| Start | 340463 |
| End | 340485 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. URIL14HWK12:I6 H043DRAFT_scaffold00005.5_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGAGGCGAAAAAAA(5' tail) GCCCGAGCGA(5' stem) ATC(loop) TCGCCCGGGC(3' stem) TTTTTCAATGGGCGG(3' tail). Confidence: 100. opp_overlap 340463 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|