| Internal ID | 17803039 | Source Database | TransTermHP TERM 353 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 353
|
| Sequence |
CGGCCTGCCTTGCGCAGGCCG Look for more occurrences |
| Start | 1135539 |
| End | 1135559 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. URMO17WK12:I4 H042DRAFT_scaffold00001.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCTTTGAAATGAAAA(5' tail) CGGCCTGC(5' stem) GCAAG(loop) GCAGGCCG(3' stem) TTTCGGGTAACGCGA(3' tail). Confidence: 100. opp_overlap 1135539 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|