| Internal ID | 17798847 | Source Database | TransTermHP TERM 75 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 75
|
| Sequence |
CCCGGGGCTGCTGCGCAGCCCCGGC Look for more occurrences |
| Start | 338125 |
| End | 338149 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAIL14HWK12:I9 D903DRAFT_scaffold00005.5_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCCTGATCTGAAATA(5' tail) GCCGGGGCTGC(5' stem) GCA(loop) GCAGCCCCGGG(3' stem) GCTCTCTCAGGCAGC(3' tail). Confidence: 95. opp_overlap 338125 338109, overlap 338123 338126 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|