| Internal ID | 17798769 | Source Database | TransTermHP TERM 91 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 91
|
| Sequence |
CGAGCGCCGCGCCGGCGGCGCTCG Look for more occurrences |
| Start | 405950 |
| End | 405973 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAIL14HWK12:I9 D903DRAFT_scaffold00004.4_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGCGCCTGTGAAAC(5' tail) CGAGCGCCGC(5' stem) CGGC(loop) GCGGCGCTCG(3' stem) ATCTCACAGGCGCCA(3' tail). Confidence: 95. overlap 405949 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|