| Internal ID | 17798418 | Source Database | TransTermHP TERM 48 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 48
|
| Sequence |
GGCCCGAGCCTATGCTTCGGGCC Look for more occurrences |
| Start | 171860 |
| End | 171882 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAIL14HWK12:I9 D903DRAFT_scaffold00001.1_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGCGGGCAAAAAAAA(5' tail) GGCCCGAAGC(5' stem) ATAG(loop) GCT-CGGGCC(3' stem) TTGAAAGGTTGAGAG(3' tail). Confidence: 100. gap 1, overlap 171871 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|