| Internal ID | 17798129 | Source Database | TransTermHP TERM 16 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 16
|
| Sequence |
GGCCACCCACATGGGTGGCC Look for more occurrences |
| Start | 35849 |
| End | 35868 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAIL14HWK12:I12 D902DRAFT_scaffold00012.12_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCGGCAATAAAAAA(5' tail) GGCCACCC(5' stem) ATGT(loop) GGGTGGCC(3' stem) TTTTCAGCGATCAGA(3' tail). Confidence: 100. opp_overlap 35849 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|