| Internal ID | 17797871 | Source Database | TransTermHP TERM 58 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 58
|
| Sequence |
CGCCGGGGCTGCACGTAGCCCCGGCG Look for more occurrences |
| Start | 318164 |
| End | 318189 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAIL14HWK12:I12 D902DRAFT_scaffold00005.5_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAGCAAAAAGGAAGA(5' tail) CGCCGGGGCTA(5' stem) CGTG(loop) CAGCCCCGGCG(3' stem) ATACCCGCTTGTTAC(3' tail). Confidence: 95. opp_overlap 318157, overlap 318162 318158 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|