| Internal ID | 17797533 | Source Database | TransTermHP TERM 4 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 4
|
| Sequence |
CGGGGCGCTCGATGCGCCCCG Look for more occurrences |
| Start | 18908 |
| End | 18928 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAIL14HWK12:I12 D902DRAFT_scaffold00001.1_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTTCTTCCACCTGAA(5' tail) CGGGGCGC(5' stem) TCGAT(loop) GCGCCCCG(3' stem) TTTCATTTATATGCC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|