| Internal ID | 17797517 | Source Database | TransTermHP TERM 53 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 53
|
| Sequence |
TCGAGCGCCGCGCGGGCGGCGCTCGA Look for more occurrences |
| Start | 213494 |
| End | 213519 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAMO17WK12:I4 D885DRAFT_scaffold00008.8, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGGTGTTTGAGAGA(5' tail) TCGAGCGCCGC(5' stem) CCGC(loop) GCGGCGCTCGA(3' stem) TCTCCAGCTCAATGC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|