Internal ID | 17797516 | Source Database | TransTermHP TERM 52 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 52
|
Sequence |
CGGGGCGACCAAGGTCGCCCCG Look for more occurrences |
Start | 210444 |
End | 210465 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas sp. LAMO17WK12:I4 D885DRAFT_scaffold00008.8, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCCTATTCAGTCAAA(5' tail) CGGGGCGAC(5' stem) CTTG(loop) GTCGCCCCG(3' stem) CTCGGGTTTACGCTT(3' tail). Confidence: 100. opp_overlap 210439 210438 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|