| Internal ID | 17797170 | Source Database | TransTermHP TERM 30 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 30
|
| Sequence |
GGCCCGCCTCAGTGCGGGCC Look for more occurrences |
| Start | 169566 |
| End | 169585 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAMO17WK12:I4 D885DRAFT_scaffold00011.11_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCGCAGATACGAAAA(5' tail) GGCCCGC(5' stem) ACTGAG(loop) GCGGGCC(3' stem) CGGGTGTGTCGCGAA(3' tail). Confidence: 93. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|