| Internal ID | 17795956 | Source Database | TransTermHP TERM 55 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 55
|
| Sequence |
GGTCAGGGCTTGTTGGCCCTGGCC Look for more occurrences |
| Start | 207955 |
| End | 207978 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAMO17WK12:I2 D883DRAFT_scaffold00003.3_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCGCGAACAAAACAA(5' tail) GGCCAGGGCC(5' stem) AACA(loop) AGCCCTGACC(3' stem) TATAAAAAACATGGG(3' tail). Confidence: 95. overlap 207952 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|