Internal ID | 17791823 | Source Database | TransTermHP TERM 1278 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1278
|
Sequence |
GCCGCGTGGCCTTTCGGCCACGCGGC Look for more occurrences |
Start | 5206060 |
End | 5206085 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas chlororaphis subsp. aureofaciens 30-84 chromosome, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TTCAGGACAAAAAAA(5' tail) GCCGCGTGGCC(5' stem) GAAA(loop) GGCCACGCGGC(3' stem) TTTTTCATGCGCTGG(3' tail). Confidence: 100. opp_overlap 5206060 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|