| Internal ID | 17788807 | Source Database | TransTermHP TERM 1027 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1027
|
| Sequence |
GCCTCTCGTTTGCACGGGAGGC Look for more occurrences |
| Start | 5085794 |
| End | 5085815 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens Q2-87 chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGTACTTATAAAAA(5' tail) GCCTCCCGT(5' stem) GCAA(loop) ACGAGAGGC(3' stem) TTTTTATTCTCCACG(3' tail). Confidence: 100. opp_overlap 5085794 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|