Internal ID | 17788490 | Source Database | TransTermHP TERM 547 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 547
|
Sequence |
GCTGGGGCGCGAAGCGGCCCTGC Look for more occurrences |
Start | 2344962 |
End | 2344984 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas fluorescens Q2-87 chromosome, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CAGCAGTCCCAAAAA(5' tail) GCAGGGCCGC(5' stem) TTC(loop) GCGCCCCAGC(3' stem) GGGAGCAAGCTCCCT(3' tail). Confidence: 93. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|