| Internal ID | 17788122 | Source Database | TransTermHP TERM 28 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 28
|
| Sequence |
GCCCGGCCTTCTGGTCGGGC Look for more occurrences |
| Start | 114379 |
| End | 114398 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens Q2-87 chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATTGCCAAGAAAAGC(5' tail) GCCCGGCC(5' stem) TTCT(loop) GGTCGGGC(3' stem) TTTTTTTTGGAATTT(3' tail). Confidence: 100. opp_overlap 114378 114377 114379, overlap 114368 114366 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|