| Internal ID | 17787498 | Source Database | TransTermHP TERM 584 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 584
|
| Sequence |
GGTGCGCCCATTTCGGGCGACACC Look for more occurrences |
| Start | 2412352 |
| End | 2412375 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas synxantha BG33R chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGCTGGTCCTTTGC(5' tail) GGTG-CGCCC(5' stem) ATTTC(loop) GGGCGACACC(3' stem) TTTATTTATCAGGAG(3' tail). Confidence: 95. gap 1 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|