| Internal ID | 17787265 | Source Database | TransTermHP TERM 267 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 267
|
| Sequence |
TGCCAGTCAGCGAGCCTGACTGGCA Look for more occurrences |
| Start | 1176187 |
| End | 1176211 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas synxantha BG33R chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGGGCGCATAAAAAA(5' tail) TGCCAGTCAG(5' stem) GCTCG(loop) CTGACTGGCA(3' stem) TTGGTTCAACCTTAC(3' tail). Confidence: 100. opp_overlap 1176187 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|