| Internal ID | 17786867 | Source Database | TransTermHP TERM 30 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 30
|
| Sequence |
CGCCCCGACTGGTTCGGGGCG Look for more occurrences |
| Start | 97109 |
| End | 97129 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas umsongensis 20MFCvi1.1 D470DRAFT_scaffold00012.12, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGTTGAACAGCAAAA(5' tail) CGCCCCGA(5' stem) CTGGT(loop) TCGGGGCG(3' stem) TTTTGCTGTGTGCAG(3' tail). Confidence: 100. opp_overlap 97109 97103, overlap 97103 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|