Internal ID | 17786241 | Source Database | TransTermHP TERM 189 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 189
|
Sequence |
CTACGGCCCGCTTGCGGGCCGTAG Look for more occurrences |
Start | 579152 |
End | 579175 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas umsongensis 20MFCvi1.1 D470DRAFT_scaffold00003.3, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCCAGTATAAACAA(5' tail) CTACGGCCCG(5' stem) CAAG(loop) CGGGCCGTAG(3' stem) AAGATGAAGCCGATC(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|