| Internal ID | 17786155 | Source Database | TransTermHP TERM 76 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 76
|
| Sequence |
GGCCCCGATCTGATCGGGGCC Look for more occurrences |
| Start | 259846 |
| End | 259866 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas umsongensis 20MFCvi1.1 D470DRAFT_scaffold00003.3, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AATCGAATTGCAAGA(5' tail) GGCCCCGAT(5' stem) CTG(loop) ATCGGGGCC(3' stem) TTTTTATTGGGTAAG(3' tail). Confidence: 100. opp_overlap 259838 259834 259846 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|