| Internal ID | 17785911 | Source Database | TransTermHP TERM 30 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 30
|
| Sequence |
CGCCAGGTTCAAACCTGGCG Look for more occurrences |
| Start | 106944 |
| End | 106963 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas mandelii 36MFCvi1.1 F626DRAFT_scaffold00011.11, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGCGCATAAAAAAA(5' tail) CGCCAGGT(5' stem) TTGA(loop) ACCTGGCG(3' stem) TTTTTTTATGCGTTG(3' tail). Confidence: 100. opp_overlap 106932 106929 106944 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|