| Internal ID | 17784341 | Source Database | TransTermHP TERM 167 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 167
|
| Sequence |
CGCCCGGGCGCACACCGCTCGGGCG Look for more occurrences |
| Start | 545373 |
| End | 545397 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas caeni DSM 24390 H591DRAFT_scaffold00001.1_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTTTTGAATGTAAAA(5' tail) CGCCCGAGCG(5' stem) GTGTG(loop) CGCCCGGGCG(3' stem) TCGGGCTTACCGAGT(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|