| Internal ID | 17783651 | Source Database | TransTermHP TERM 82 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 82
|
| Sequence |
GGCCGGCAGCGAAAGTTGCCGGCC Look for more occurrences |
| Start | 215085 |
| End | 215108 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. URIL14HWK12:I4 H025DRAFT_scaffold00006.6_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCAAGTAAGCACGAA(5' tail) GGCCGGCAGC(5' stem) GAAA(loop) GTTGCCGGCC(3' stem) TTTTTGTTGGCCGGT(3' tail). Confidence: 100. opp_overlap 215078 215085 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|