| Internal ID | 17783371 | Source Database | TransTermHP TERM 18 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 18
|
| Sequence |
CCCCGTATCCGCAAGGATGCGGGG Look for more occurrences |
| Start | 57288 |
| End | 57311 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. URIL14HWK12:I4 H025DRAFT_scaffold00002.2_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCCAGACGCGAAAG(5' tail) CCCCGTATCC(5' stem) GCAA(loop) GGATGCGGGG(3' stem) TTTTTTATTGGCGGC(3' tail). Confidence: 100. opp_overlap 57288 57287 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|