Internal ID | 17783250 | Source Database | TransTermHP TERM 133 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 133
|
Sequence |
GGGCAACCCTCGGGTCGCCC Look for more occurrences |
Start | 555283 |
End | 555302 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas sp. LAIL14HWK12:I7 D886DRAFT_scaffold00002.2, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GATCGGTAAGAAAAA(5' tail) GGGCAACC(5' stem) CTCG(loop) GGTCGCCC(3' stem) TTTTTTTATGCCTGT(3' tail). Confidence: 100. opp_overlap 555283, overlap 555272 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|