| Internal ID | 17782866 | Source Database | TransTermHP TERM 55 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 55
|
| Sequence |
GCCGACCCACTTGTGGGTCGGC Look for more occurrences |
| Start | 361425 |
| End | 361446 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAIL14HWK12:I7 D886DRAFT_scaffold00006.6_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACGGATTGTTATGAA(5' tail) GCCGACCCA(5' stem) CTTG(loop) TGGGTCGGC(3' stem) TTTTTTATTGCCGCG(3' tail). Confidence: 100. opp_overlap 361425 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|