| Internal ID | 17782813 | Source Database | TransTermHP TERM 158 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 158
|
| Sequence |
GGGGCTATCCGTACGGGATAGCCCC Look for more occurrences |
| Start | 612643 |
| End | 612667 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. LAIL14HWK12:I7 D886DRAFT_scaffold00003.3_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCTGCATACAAAAA(5' tail) GGGGCTATCC(5' stem) CGTAC(loop) GGATAGCCCC(3' stem) TCTTGGTACTTCTAC(3' tail). Confidence: 100. opp_overlap 612641 612643 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|