| Internal ID | 17781720 | Source Database | TransTermHP TERM 508 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 508
|
| Sequence |
CATCGGCCAGCTCTGCTGGTCGATG Look for more occurrences |
| Start | 1457519 |
| End | 1457543 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. 45MFCol3.1 G368DRAFT_scaffold00001.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGAAGGCGCAAATGA(5' tail) CATCGACCAGC(5' stem) AGA(loop) GCTGGCCGATG(3' stem) TTTGGAACCGTCAGC(3' tail). Confidence: 93. opp_overlap 1457519, overlap 1457516 1457521 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|