| Internal ID | 17781299 | Source Database | TransTermHP TERM 12 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 12
|
| Sequence |
GCCGACCCGGAACCGGGTCGGC Look for more occurrences |
| Start | 41569 |
| End | 41590 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas thermotolerans DSM 14292 H165DRAFT_scaffold00026.26, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGCGGCCAATAAAAA(5' tail) GCCGACCCG(5' stem) GAAC(loop) CGGGTCGGC(3' stem) TTATATAGCCACGAA(3' tail). Confidence: 100. opp_overlap 41569 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|